Top » Catalog » I2 » A17068

$18.00

A17068
[A17068]

A17068
hg38 Position: ChrY:13268431..13268431
Ancestral: T
Derived: C
Reference: David Nicolson (2017)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: A17068_F CCCGTCACTTTCAGGTGTATC
Reverse Primer: A17068_R GCAAGGGAACAAAACTGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y5319
$18.00
Haplogroup Info
Other products
Currencies