Top » Catalog » I2 » A17069

$18.00

A17069
[A17069]

A17069
hg38 Position: ChrY:14330529..14330529
Ancestral: C
Derived: A
Reference: David Nicolson (2017)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: A17069_F TTAGTGCCAATTCCAAACTCC
Reverse Primer: A17069_R TCAAGCCATGAAAGACATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies