Top » Catalog » I2 » BY3099

$18.00

BY3099
[BY3099]

BY3099
hg38 Position: ChrY:2862523..2862523
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: BY3099_F ACCATGCCTAGCTGTGATCC
Reverse Primer: BY3099_R GCACAAACCAAATGCAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies