Top » Catalog » I2 » S2364

$18.00

S2364
[S2364]

S2364
hg38 Position: ChrY:20890720..20890720
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a2a
Comments: Downstream CTS6433
Forward Primer: S2364_F GATGTAGAACTAGAAATACCATTTGCG
Reverse Primer: S2364_R TTCTTTCTTTCTTTTTTTTAATTATACTTTAAGG
Reviews

Customers who bought this product also purchased
S17264
S17264
FGC3617
FGC3617
Y30320
Y30320
Y17377
Y17377
PH4203
PH4203
Y4771
Y4771
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies