Top » Catalog » I2 » A17271

$18.00

A17271
[A17271]

A17271
hg38 Position: ChrY:15214085..15214085
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17271_F TTGTGATGGGAATTGGGTTC
Reverse Primer: A17271_R AAACATCGCCTTCTCTGAGC
Reviews

Customers who bought this product also purchased
I2a-CTS595 Panel
I2a-CTS595 Panel
PF4088
PF4088
Z105
Z105
CTS1758
CTS1758
A19395
A19395
L160
L160
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies