Top » Catalog » I2 » A17272

$18.00

A17272
[A17272]

A17272
hg38 Position: ChrY:19228931..19228931
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17272_F TGCTCTGTCACTCAGGATGG
Reverse Primer: A17272_R GGTCATGTGATGGGAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S15581
$18.00
Haplogroup Info
Other products
Currencies