Top » Catalog » I2 » A17275

$18.00

A17275
[A17275]

A17275
hg38 Position: ChrY:19814766..19814766
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17275_F CAATTTTGATATCTGATGTCTGTGC
Reverse Primer: A17275_R AAGGGGTATAGTGGGGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies