Top » Catalog » I2 » CTS4092

$18.00

CTS4092
[CTS4092]

CTS4092
hg38 Position: ChrY:13280014..13280014
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2c1a2a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS4092_F GCTGTTTTGAGGAACCACAAC
Reverse Primer: CTS4092_R CAAAGTGCTGGCATTACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies