Top » Catalog » I2 » PH1237

$18.00

PH1237
[PH1237]

PH1237
hg38 Position: ChrY:12327761..12327761
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a2b2 (not listed)
Comments: Below S2606.
Forward Primer: PH1237_F TTATTTGTTTGAGCAGCAATAAATAGG
Reverse Primer: PH1237_R ACGCACTGGCTGTTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies