Top » Catalog » I2 » S2606

$18.00

S2606
[S2606]

S2606
hg38 Position: ChrY:20365516..20365516
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2b2
Comments: Below L38, parallel to BY14072
Forward Primer: S2606_F GTTGTGGTCCATGCCTGTAG
Reverse Primer: S2606_R TCATTTTTACACCAAAATTTGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies