Top » Catalog » I2 » Y4955

$18.00

Y4955
[Y4955]

Y4955
hg38 Position: ChrY:13250282..13250282
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a2a3
Comments: Below S2364.
Forward Primer: Y4955_F ATAAACATCCACCACCTTGC
Reverse Primer: Y4955_R CTTGATGGAGCTTGCTTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies