Top » Catalog » I2 » Y6882

$18.00

Y6882
[Y6882]

Y6882
hg38 Position: ChrY:14470412..14470412
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a2a2b (not listed)
Comments: Below Y4926 and above Y6883. Syn with S8104.
Forward Primer: Y6882_F AAGACCCATCCCATAATGAAG
Reverse Primer: Y6882_R CTGCTAATGTGGCTCAGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1612
1 x Y6469
1 x A705
1 x F1300
$72.00
Haplogroup Info
Other products
Currencies