Top » Catalog » I2 » Y5367

$18.00

Y5367
[Y5367]

Y5367
hg38 Position: ChrY:17111742..17111742
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b1a1a1 (not listed)
Comments: Below S23612, above Y5359.
Forward Primer: Y5367_F TTTTGTTTATCTTAGCCTCATGG
Reverse Primer: Y5367_R AGTCAGCTGAAGCCGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies