Top » Catalog » I2 » FGC15072

$18.00

FGC15072
[FGC15072]

FGC15072
hg38 Position: ChrY:19990512..19990512
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a2a1a (not listed)
Comments: Below CTS616, syn with Y3721. Aka Y4757.
Forward Primer: FGC15072_F GGTTCAGTTTGCCAGAATTTTAC
Reverse Primer: FGC15072_R AAATAACTAAGATCACAGCAGAATTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20215
$18.00
Haplogroup Info
Other products
Currencies