Top » Catalog » I2 » A824

$18.00

A824
[A824]

A824
hg38 Position: ChrY:7828955..7828955
Ancestral: G
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: I2a2a1a1a1a1a2a1
Comments: Below Y4750. aka YFS219441
Forward Primer: A824_F GTTTGGAACAGTATACATACTATTTGCA
Reverse Primer: A824_R TCCCATAAGCCTGACACCTG
Reviews

Customers who bought this product also purchased
A7395
A7395
BY141000
BY141000
A10024
A10024
A11616
A11616
A2239
A2239
Y11858
Y11858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies