Top » Catalog » I2 » A824

$18.00

A824
[A824]

A824
hg38 Position: ChrY:7828955..7828955
Ancestral: G
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: I2a2a1a1a1a1a2a1
Comments: Below Y4750. aka YFS219441
Forward Primer: A824_F GTTTGGAACAGTATACATACTATTTGCA
Reverse Primer: A824_R TCCCATAAGCCTGACACCTG
Reviews

Customers who bought this product also purchased
A11616
A11616
L126
L126
A2228
A2228
I2a-M284 Panel
I2a-M284 Panel
A11612
A11612
A5860
A5860
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies