Top » Catalog » I2 » Y4724

$18.00

Y4724
[Y4724]

Y4724
hg38 Position: ChrY:19090294..19090294
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a2a1a1c (not listed)
Comments: Below Y4718.
Forward Primer: Y4724_F TGAAAATCAAATCCCCAAGG
Reverse Primer: Y4724_R CACTCTTTGACTGAGGGAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY172.1
1 x A5914
1 x BY6568
1 x BY7536
$72.00
Haplogroup Info
Other products
Currencies