Top » Catalog » I2 » Y4725

$18.00

Y4725
[Y4725]

Y4725
hg38 Position: ChrY:19064182..19064182
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a2a1a1c (not listed)
Comments: Below Y4332.
Forward Primer: Y4725_F CAGGATTAGGGGCAGAAATG
Reverse Primer: Y4725_R ATGTGCGTGTGACGCTAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies