Top » Catalog » I2 » A17458

$18.00

A17458
[A17458]

A17458
hg38 Position: ChrY:17390559..17390559
Ancestral: C
Derived: T
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below Y4751 > Y12714
Forward Primer: A17458_F TTGATGGATCTATGGTTGTTTTTC
Reverse Primer: A17458_R TCCTGTTGATGCCAATGTAAAC
Reviews

Customers who bought this product also purchased
A17456
A17456
A17462
A17462
A17455
A17455
A17461
A17461
A17460
A17460
A17459
A17459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies