Top » Catalog » I2 » A17461

$18.00

A17461
[A17461]

A17461
hg38 Position: ChrY:21136529..21136529
Ancestral: T
Derived: G
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below Y4751 > Y12714
Forward Primer: A17461_F AGAATCCAGCAGCTCCTCAC
Reverse Primer: A17461_R CACCGTGGCACACATATACC
Reviews

Customers who bought this product also purchased
A17455
A17455
A17460
A17460
A17459
A17459
A17458
A17458
A17464
A17464
A17457
A17457
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1150
1 x FGC15136
$36.00
Haplogroup Info
Other products
Currencies