Top » Catalog » I2 » A17462

$18.00

A17462
[A17462]

A17462
hg38 Position: ChrY:8439372..8439372
Ancestral: G
Derived: C
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below Y4751 > Y12714
Forward Primer: A17462_F TGCTTGACCCAGGTATTTGTC
Reverse Primer: A17462_R CCAGCAAACAGTTCAGATTGG
Reviews

Customers who bought this product also purchased
A17457
A17457
A17463
A17463
A17456
A17456
A17461
A17461
A17455
A17455
A17460
A17460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies