Top » Catalog » I2 » A17709

$18.00

A17709
[A17709]

A17709
hg38 Position: ChrY:13162183..13162183
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4135
Forward Primer: A17709_F AAGTTGAGCTCCATCTCCTG
Reverse Primer: A17709_R GCAGTTTTTCCAGAGTTTGTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies