Top » Catalog » I2 » A17273

$18.00

A17273
[A17273]

A17273
hg38 Position: ChrY:15483664..15483664
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17273_F GCCATGATTTCTTTAGTTGAATTCC
Reverse Primer: A17273_R CCCACATCTTATATTTCTTTTTCCC
Reviews

Customers who bought this product also purchased
CTS595
CTS595
CTS1758
CTS1758
I2a-CTS595 Panel
I2a-CTS595 Panel
Z105
Z105
PF4125
PF4125
PF4088
PF4088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies