Top » Catalog » I2 » F1295

$18.00

F1295
[F1295]

F1295
hg38 Position: ChrY:8677453..8677453
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: I2a1a1a1b
Comments: Below L160
Forward Primer: F1295_F CAGGGCTCTTTGGGTGATAG
Reverse Primer: F1295_R GCACAGCATTCTCATTGTGG
Reviews

Customers who bought this product also purchased
CTS1758
CTS1758
A19395
A19395
L160
L160
L1299
L1299
M26
M26
A17271
A17271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7718
$18.00
Haplogroup Info
Other products
Currencies