Top » Catalog » I2 » BY13388

$18.00

BY13388
[BY13388]

BY13388
hg38 Position: ChrY:8665106..8665106
Ancestral: C
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: I2
Comments: Downstream Z161 > L801 > CTS1977 > Y4946 > Y5282 > Y11229
Forward Primer: BY13388_F CAAAAATAAACCTTGAAATCCATAAGG
Reverse Primer: BY13388_R ACACGCAAACCCAGAGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies