Top » Catalog » I2 » A17998

$18.00

A17998
[A17998]

A17998
hg38 Position: ChrY:12977677..12977677
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below S2742
Forward Primer: A17998_F AAAGGGTTCAATTCTCCAAGG
Reverse Primer: A17998_R TCCCACATGGTTACCTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF6328
$18.00
Haplogroup Info
Other products
Currencies