Top » Catalog » I2 » A17999

$18.00

A17999
[A17999]

A17999
hg38 Position: ChrY:13653614..13653614
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below S2742
Forward Primer: A17999_F AAGTGGTTTGCGATGAAAGC
Reverse Primer: A17999_R AGCATGGCAAAATGGAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies