Top » Catalog » I2 » A18000

$18.00

A18000
[A18000]

A18000
hg38 Position: ChrY:14336989..14336989
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below S2742 > A1514
Forward Primer: A18000_F CCCTGAGTTCATGGCAAAAC
Reverse Primer: A18000_R GACAAAGGCAAAGTTTGAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT21353
1 x A11209
$36.00
Haplogroup Info
Other products
Currencies