Top » Catalog » I2 » A18001

$18.00

A18001
[A18001]

A18001
hg38 Position: ChrY:2955515..2955515
Ancestral: A
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below A1150
Forward Primer: A18001_F CCCCGGTTCTCAAATATGTC
Reverse Primer: A18001_R GAATTCCAGAGGCAGGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies