Top » Catalog » I2 » A18004

$18.00

A18004
[A18004]

A18004
hg38 Position: ChrY:12821140..12821140
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below A1150
Forward Primer: A18004_F TTGTCCTCTCAGTGATTCTCTCC
Reverse Primer: A18004_R CAGAAAGGCCATATATGCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies