Top » Catalog » I2 » A18005

$18.00

A18005
[A18005]

A18005
hg38 Position: ChrY:13023517..13023517
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below A1150
Forward Primer: A18005_F CCTGATATTTGCAGCTGTGC
Reverse Primer: A18005_R TGTTGAGCTTGGATCTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23893
$18.00
Haplogroup Info
Other products
Currencies