Top » Catalog » I2 » S12480

$18.00

S12480
[S12480]

S12480
hg38 Position: ChrY:9954368..9954368
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2
Comments: Below Y31085
Forward Primer: S12480_F GGAGAACAAACAAGAAACAGTTCG
Reverse Primer: S12480_R AGATGGTGATCTCCACATTACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies