Top » Catalog » I2 » S7753

$18.00

S7753
[S7753]

S7753
hg38 Position: ChrY:15491171..15491171
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1a1a1a
Comments: Aka FGC20048. below L126
Forward Primer: S7753_F AGAAATGCAATATGGGCTGC
Reverse Primer: S7753_R CCTTTTGGCTCCCGTAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1146
$18.00
Haplogroup Info
Other products
Currencies