Top » Catalog » I2 » A18711

$18.00

A18711
[A18711]

A18711
hg38 Position: ChrY:2931221..2931221
Ancestral: C
Derived: T
Reference: Nathaniel Austin Gray (2017)
ISOGG Haplogroup: I2a
Comments: Approx. BY13389
Forward Primer: A18711v2_F AGGCTGGTCTTGAACTTCTGAG
Reverse Primer: A18711v2_R CCAGGATAGTCTTGATTTCCTGAG
Reviews

Customers who bought this product also purchased
A18720
A18720
A18714
A18714
A18719
A18719
A18713
A18713
A18718
A18718
A18712
A18712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies