Top » Catalog » I2 » A18711

$18.00

A18711
[A18711]

A18711
hg38 Position: ChrY:2931221..2931221
Ancestral: C
Derived: T
Reference: Nathaniel Austin Gray (2017)
ISOGG Haplogroup: I2a
Comments: Approx. BY13389
Forward Primer: A18711v2_F AGGCTGGTCTTGAACTTCTGAG
Reverse Primer: A18711v2_R CCAGGATAGTCTTGATTTCCTGAG
Reviews

Customers who bought this product also purchased
A18718
A18718
A18712
A18712
A18717
A18717
I2a-Y5282 Gray Segregation Panel
I2a-Y5282 Gray Segregation Panel
A18716
A18716
A18721
A18721
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies