Top » Catalog » I2 » A18721

$18.00

A18721
[A18721]

A18721
hg38 Position: ChrY:15470084..15470084
Ancestral: T
Derived: A
Reference: Nathaniel Austin Gray (2017)
ISOGG Haplogroup: I2a (not listed)
Comments: Approx. BY13389
Forward Primer: A18721v2_F AGCTTATTTGTTCTATGGGTTGATG
Reverse Primer: A18721v2_R AGATAAAGCCAATATCAGGGGAC
Reviews

Customers who bought this product also purchased
A18713
A18713
A18718
A18718
A18712
A18712
A18717
A18717
A18711
A18711
A18716
A18716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies