Top » Catalog » I2 » A18791

$18.00

A18791
[A18791]

A18791
hg38 Position: ChrY:12496510..12496510
Ancestral: A
Derived: G
Reference: Jakub Krchak (2017)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882
Forward Primer: A18791_F TCCTGGGCTTGTAGATGCTG
Reverse Primer: A18791_R TTATTTCTGTAAGGGCTGGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies