Top » Catalog » I2 » FGC71328

$18.00

FGC71328
[FGC71328]

FGC71328
hg38 Position: ChrY:6863586..6863586
Ancestral: C
Derived: A
Reference: Colin Munro (2017)
ISOGG Haplogroup: I2
Comments: Below Y12073 & Y12059
Forward Primer: FGC71328_F CCATCTCATCCTCCATCCAG
Reverse Primer: FGC71328_R CCAGAAGAAGGAGCAACCAC
Reviews

Customers who bought this product also purchased
FGC71327
FGC71327
FGC71335
FGC71335
FGC71334
FGC71334
FGC71333
FGC71333
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies