Top » Catalog » I2 » FGC71333

$18.00

FGC71333
[FGC71333]

FGC71333
hg38 Position: ChrY:13348904..13348904
Ancestral: T
Derived: A
Reference: Colin Munro (2017)
ISOGG Haplogroup: I2
Comments: Below Y12073 & Y12059
Forward Primer: FGC71333_F TTAGTCCAGCATTGTTCAACC
Reverse Primer: FGC71333_R TGGAGATTCCCTAAGGCTTG
Reviews

Customers who bought this product also purchased
FGC71335
FGC71335
FGC71334
FGC71334
FGC71328
FGC71328
FGC71327
FGC71327
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L161.1
$18.00
Haplogroup Info
Other products
Currencies