Top » Catalog » I2 » FGC71335

$18.00

FGC71335
[FGC71335]

FGC71335
hg38 Position: ChrY:19510681..19510681
Ancestral: G
Derived: A
Reference: Colin Munro (2017)
ISOGG Haplogroup: I2
Comments: Below Y12073 & Y12059
Forward Primer: FGC71335_F TTGCAGAAATAGGAAAAACCATC
Reverse Primer: FGC71335_R TGGTTGAGCCATTTTGATTTG
Reviews

Customers who bought this product also purchased
FGC71327
FGC71327
FGC71334
FGC71334
FGC71333
FGC71333
FGC71328
FGC71328
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies