Top » Catalog » I2 » A19300

$18.00

A19300
[A19300]

A19300
hg38 Position: ChrY:14141640..14141640
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below L160 > CTS1758
Forward Primer: A19300_F AGGGAACAGTCATCTGCAGTC
Reverse Primer: A19300_R TGGTGCCTTAGTGTGACCAG
Reviews

Customers who bought this product also purchased
Z27034
Z27034
Y24017
Y24017
A17271
A17271
A19455
A19455
Y84185
Y84185
BY130413
BY130413
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies