Top » Catalog » I2 » A19300

$18.00

A19300
[A19300]

A19300
hg38 Position: ChrY:14141640..14141640
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below L160 > CTS1758
Forward Primer: A19300_F AGGGAACAGTCATCTGCAGTC
Reverse Primer: A19300_R TGGTGCCTTAGTGTGACCAG
Reviews

Customers who bought this product also purchased
M26
M26
CTS1758
CTS1758
CTS595
CTS595
A17273
A17273
I2a-CTS595 Panel
I2a-CTS595 Panel
Z105
Z105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF3853
$18.00
Haplogroup Info
Other products
Currencies