Top » Catalog » I2 » A19304

$18.00

A19304
[A19304]

A19304
hg38 Position: ChrY:14681067..14681067
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below FGC7174
Forward Primer: A19304_F TGAGCAGGAAACATAGGCAAG
Reverse Primer: A19304_R GCCATGCGGAACTGTAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies