Top » Catalog » I2 » A19381

$18.00

A19381
[A19381]

A19381
hg38 Position: ChrY:12884098..12884098
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L161.1 > A13665 > Y37101
Forward Primer: A19381_F AGGTGTGAGCCACTGTACCC
Reverse Primer: A19381_R CACATGTACCCCCTTGAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies