Top » Catalog » I2 » A19382

$18.00

A19382
[A19382]

A19382
hg38 Position: ChrY:12964792..12964792
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below CTS1758
Forward Primer: A19382_F TCCATTGGAGGTGCTATGTTC
Reverse Primer: A19382_R ACCTCCAGCACCCTTGTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A21070
$18.00
Haplogroup Info
Other products
Currencies