Top » Catalog » I2 » A19385

$18.00

A19385
[A19385]

A19385
hg38 Position: ChrY:15683131..15683131
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233
Forward Primer: A19385_F TAAAAGGGACCCCAGAGAGG
Reverse Primer: A19385_R GGAGATGGGGGTATGGTTTC
Reviews

Customers who bought this product also purchased
FGC56855
FGC56855
L1286
L1286
A19485
A19485
Y33761
Y33761
Y4252
Y4252
A417
A417
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20327
$18.00
Haplogroup Info
Other products
Currencies