Top » Catalog » I2 » A19455

$18.00

A19455
[A19455]

A19455
hg38 Position: ChrY:14624721..14624721
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below CTS1758 > Z27034
Forward Primer: A19455_F AGGGTGGACGTTTCATTGTG
Reverse Primer: A19455_R TGATGCCAACATTTCAGTAGG
Reviews

Customers who bought this product also purchased
A17271
A17271
PF4125
PF4125
I2a-CTS595 Panel
I2a-CTS595 Panel
CTS1758
CTS1758
BY130413
BY130413
Z105
Z105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies