Top » Catalog » I2 » A19475

$18.00

A19475
[A19475]

A19475
hg38 Position: ChrY:16728376..16728376
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below Y11222 > Y14720 > Y63853
Forward Primer: A19475_F GGCACAGGAAATTCATCAGG
Reverse Primer: A19475_R CAGACATGTGGGTGGGAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5314
1 x BY6705
$36.00
Haplogroup Info
Other products
Currencies