Top » Catalog » I2 » A20031

$18.00

A20031
[A20031]

A20031
hg38 Position: ChrY:12619860..12619860
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below S17250 > Y4882 > PLE07
Forward Primer: A20031_F TCATCTTCCATTGGCATGAG
Reverse Primer: A20031_R TCTGAGGCCCTTTTTGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1514
1 x L1287
$36.00
Haplogroup Info
Other products
Currencies