Top » Catalog » I2 » A20339

$18.00

A20339
[A20339]

A20339
hg38 Position: ChrY:19709134..19709134
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: A20339_F TGAGAGCCTGGATGTTAGGC
Reverse Primer: A20339_R ACTCCCAGTTGGGCATCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies