Top » Catalog » I2 » FGC56855

$18.00

FGC56855
[FGC56855]

FGC56855
hg38 Position: ChrY:16563006..16563006
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: I2a
Comments: Below CTS595 > FGC56815
Forward Primer: FGC56855_F CCAGCGACTGAATCTTTCTTACAC
Reverse Primer: FGC56855_R GGACTTTATTTAGAGCACACTCATATATTG
Reviews

Customers who bought this product also purchased
I2a-CTS595 Panel
I2a-CTS595 Panel
A10033
A10033
Y4200
Y4200
L1286
L1286
A15050
A15050
Y4252
Y4252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies